VNG0075
Gene VNG0075 in replicon chromosome
Vng75 is interrupted by ISH9, a 180 bp insertion element which creates an 8 bp target site duplication (GCTACGAAC) 214 bp from the ATG start. The whole vng75 sequence without ISH9 inserted is expected to be 303 bp and code a 100 amino acid protein:
Whole vng75|75|68290|For|68593 atggtgcccaagcccactgagtcgtggaaagaggatatgaccgggcgggaacgcgtccgggca gtcacgcaaacactcgaaggcgctgccacagtctcggagatcgcagaccgtgctggggtttcc ccaacaaccgcaagcgacgagctggcacaactcgaatcagccaaccgggttcgcaagacactc gtcgacgaccagaaaggctacgaactgaatccaacgcaaatgttcttcgacgaactgctggaa ctcatcgaggaacatacccgagacgaactcgaacacaactggagcaactga
- More about this gene
- Blast DNA databases using NCBI Blast
- Blast protein databases using NCBI Blast
- Get protein data of this gene from GenBank
- See protein structure at GTOP
- Protein interactions at STRING
- Retrieve flanking sequence
Gene ID | Name | Size (bp) | Annotation |
---|---|---|---|
70 | vng70 | 291 | no entry |
72 | nbp1 | 432 | no entry |
73 | vng73 | 294 | no entry |
75 | vng75 | 222 | no entry |
76 | vng76 | 117 | no entry |
77 | vng77 | 780 | no entry |
79 | vng79 | 213 | no entry |