The Haloarchaeal Genome Database

Sequence Editor

Input Window (Single sequence only. format: fasta, GCG, or plain sequence. Numbers and spaces are okay.)

>trn22|3019|990847|Rev|990773|nrc1
gctccgttggtgtagtccggccaatcatcttgccctctcacggcaaggactagggttcaaatccctgacggagca

Output Window

Select Operation

Base Operations To RNA To DNA Remove non-DNA characters
Reverse Complimentary Complimentary + Reverse

Formatting Operations To Triplets To Lower Case To Upper Case To Single-lined

Strand Operations To Double Strand To Top Strand To Bottom Strand

Spacing/Numbering Operations Remove Spaces Remove Numbers Remove Spaces and Numbers Number/Re-number It Bases Per Line

Translation Operations Translate It

Sequence Format Format It

Miscellaneous Operations Search sub-sequence