Sequence Editor

Did you know? A new version of the Sequence Editor is coming - try out the development version.

Sequence Editor

Input Window (Single sequence only. format: fasta, GCG, or plain sequence. Numbers and spaces are okay.)

>eif1a1|2234|1663416|Rev|1663132|nrc1
atgagcgacgacggcggcggacgcaagaacttgcgaatgcccgaggacgacgaggtgttcgcggaggtcacggacatgctcggcgcgaaccgcgtgcaggtgcggtgtgcggacggcgaggagcggacggcgcgcatccccggccggatgcaaaagcgcatctggatccgcgaggacgacatcgtgctcgtggagccctgggactggcaggacgacaaggccgacgtgacgtggcgctacgagaaaagcgacgccgaccagctccgcgaggaagggcacatcgaatga

To RNA	To DNA	To Triplets
To Lower Case	To Upper Case	To Single-lined
To Double Strand	To Top Strand	To Bottom Strand
Reverse	Complimentary	Complimentary + Reverse
Remove Spaces	Remove Numbers	Remove Spaces and Numbers
Number/Re-number It	Bases Per Line	Remove non-DNA characters
Translate It
Format It
Search sub-sequence

Output Window