The Haloarchaeal Genome Database

Log in
Haloarchaeal Genomes
DasSarma Home
UMB

HaloWeb Genomes
Halobacterium sp NRC-1
Halorubrum lacusprofundi
Search Genomes
Comparative Genomics
Sequence Editor
Resources

Loading

Loading...

Did you know? A new version of the Sequence Editor is coming - try out the development version.

Sequence Editor

Input Window (Single sequence only. format: fasta, GCG, or plain sequence. Numbers and spaces are okay.)

>trn31|3029|1412690|For|1412763|nrc1
gggtcagtagctcaactaggtagagcgccactctgataaggtggaggcttgcggttcaaatccgcactgaccca

To RNA	To DNA	To Triplets
To Lower Case	To Upper Case	To Single-lined
To Double Strand	To Top Strand	To Bottom Strand
Reverse	Complimentary	Complimentary + Reverse
Remove Spaces	Remove Numbers	Remove Spaces and Numbers
Number/Re-number It	Bases Per Line	Remove non-DNA characters
Translate It
Format It
Search sub-sequence

Output Window

Last Updated: 2018-05-31T23:16:28, r1527808588 public-prod Switch to Dev

Copyright © Shiladitya DasSarma.

Haloweb is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.

Please direct your content comments to Dr. Shiladitya DasSarma and technical comments to the Webmaster Ryuu.